Part A: map your sRNAs to a collected TAS to detect the TAS expression in your sample
Select a TAS:
Input sRNAs:
(length:17-25 nt)
Format1 (Sequence_Sequencing Number):
TTGAGCAAGAAATTATAAG_138;
Format2 (Sequence):
TTGAGCAAGAAATTATAAGC;
Format3:FASTA
OR Upload sRNA file:
Parameters:Allowed offset from phased position:
Cut-off filtering low-abundant sRNA:
Input degradome
sequences, if you have:
Format1
OR
Format2
OR
Format3
OR Upload degradome file:
Part B: Map your sRNAs to your TAS and detect TAS expression in your sample
Input your DNA sequence and annotate it: The length of TAS should be a multiple of 21.
TAS Region: Initial Site:
Input sRNAs:
(length:17-25 nt)
Format1(Sequence_Sequencing Number):
TTGAGCAAGAAATTATAAG_138;
Format2 Sequence):
TTGAGCAAGAAATTATAAGC_2899;
Format3:FASTA
OR Upload small RNA file:
Parameters:Allowed offset from phased position:
Cut-off filtering low-abundant sRNA:
Input degradome
sequences, if you have:
Format1
OR
Format2
OR
Format3
OR Upload degradome file: