tasiRNAdb Table

    tasiRNAdb Table

TasExpAnalysis

    Map Result
    Computational Result
    sRNAs Distribution


tasiRNAdb Table    [Go Top]

1.Sort and Filter

tasiRNAdb table contents can be sorted by clicking the buttons of taxon, including 'NO.', 'Species', 'Phase initiator1', 'ta-siRNA-producing locus', 'Phase initiator2', 'trans-acting siRNA', 'ta-siRNA tageting gene', and 'Refence'. It can also be filtered by inputting appropriate character(s)and clicking Enter key. (see below figure)

              

2.ta-siRNA regulatory pathways

To now, a great deal of basically regulatory pathways have been discovered in plants.

            phased initiator  (It usually is a miRNA, but also might be a ta-siRNA in some cases, for example, 
                    |          athTAS2-tasiR2140 initiate At1g63130 to produce siR9as (Chen et al, 2007, PNAS); Its number usually 
                    |          is one, but also might be two, for example, TAS3 is targeted by two miR390s (Axtell et al, 2006, Cell).) 
                    V              
                   TAS---->ta-siRNA
                             |
                             |
                             V
                        target gene
A below figure from Allen et al(2005 PMID: 15851028) detailedly illustrates the pathway. In which, a single-stranded RNA is first transcribed from a ta-siRNA-generating locus and then cleaved by a phased initiator. RDR6-dependent conversion of the resulting fragments into double-stranded RNA, and subsequent cleavage by DICER-Like 4, generates 21-nt phased ta-siRNAs. These ta-siRNAs then combine with argonaute proteins to form RISC complexes and cleave targeted mRNAs.

3.Format in each record

Species ID:     	2                                                          Species identity in tasiRNAdb.
English Name:   	Grape
Scientific name:	Vitis vinifera                                           Link to NCBI taxonomy.
//

PhaseInit ID: 	2                                                                  Phase initiator identity in tasiRNAdb.
Name:         	vvi-miR390[PMRD]                                                   Link to PMRD database.
Sequence:     	AAGCUCAGGAGGGAUAGCGCC
Cleaved Pos:  	10
Targeted SEQ: 	TTGTCTATCCCTCCTGAGCTA
Used Method:  	Experimental Degradome analysis                                     It was identified by degradome analysis, which 
//                                                                                  belongs to an experimental method.

TAS ID:     	2                                                                   TAS identity in tasiRNAdb.
Discription:	vviTAS3
Coordinate: 	chr5:359214..359381-                                                If the genomic coordinate is unavailable, a locus ID  
Transcript: 	ggctggttggtgttaattgggtgctatcctacctgagctttttcttcgttgtttttttta        from Genbank will be provided like chr0:000..000(see GQ420307) 
              	tatttttcatcgtttttttttttattctctttttcttgtc[ttcttgaccttgtaagacc        The start position of TAS region was maker by '['.
              	ttttcttgaccttgtaagaccctgttgtgcgcatttcttcttcgttttccatcttgtcat
              	gaactctataccagcaccgactgacatagagttcggccatcgtgttccccgtttccgccc
              	aactcatgttctccttccttgtctatccc]tcctgagctattggaattga                  The end position of TAS region was maker by ']'.
TAS region: 	101..268                                                            The start position and end position of TAS in above sequence.
m/siR TAR: 	TTGTCTATCCCTCCTGAGCTA                                               The target site of phased initiator(miR or siR).
Used Method:   	Degradome analysis                                                  The method used to determine phase start point.
Producing :                                                                         The name and sequence of ta-siRNA produced from TAS.
  Name:         vviTAS3-tasiRM1a
  Sequence:   	GATAGACAAGGAAGGAGA
//

tasiRNA ID:   	1                                                                   ta-siRNA identity in tasiRNAdb.
Name:         	vviTAS3-tasiRM1a
Sequence:     	GATAGACAAGGAAGGAGA
Cleaved Pos:  	10
Targeted SEQ: 	GCTCCTTCCTTGCTTCCT
Used Method:  	Experimental Degradome analysis
//

tasiRTargetID:	1                                                                   The identify of ta-siRNA target in tasiRNAdb.
Name:         	GSVIVT01006533001
Sequence:     	TCATCAGCATCGAGAGTGGTGAGCCCTTGATGACGTGGCAGCCATGGTCACTGCCACACT
              	CTATTAAGGCGGACCTCACCACACATCTGGCATACTACTCCTTCACTACTCTCTACTCTC
              	TCCCATCTCTCTAGACTCCTCCATCCTACAAACTTCCTCCAATCCGTTGCAGCAGCAACA
              	TCAACTCATCCACTACCGATAGGTAAAGATGGAGAAGGAAATGATCGCGACCTTCATCTC
              	CTCCGCTGCCTACGCTCCTTCCTTGCTTCCTCTGCTGTCTCCCTCTCGTAATCTCAATTT
              	CAGGTGTTTATCACCGTTGAAGGCGAATCCACAGCGATGTGTCGTCGGCGGCACCAAGCG
              	GCTTTGTAGCGTGGTTGCTGCTAGAGGAAATTTGGAGTCGACGGGTGTGCCGACGTCGGT
              	GCCGGTGCGCGTGGCGCTCGAGCTTCTTCAAGCTGGACATCGGACTCCTGAA
Targeted SEQ: 	GCTCCTTCCTTGCTTCCT                                                  The ta-siRNA's target site in its targeting gene.
Used Method:  	Degradome analysis                                                  The method used to determine ta-siRNA's cut point on its targeting site.
//

References:
zhang(2012)                                                                       Link to Pubmed database. If the PubID does not exit, a 0_ID
//                                                                                  will be designated.


TasExpAnalysis    [Go Top]

Part1.Map Result

721 1 63 61 2 1 21 #------------------->#-------------------> tggaatactcacTTGAGCAAGAAATTATAAGCACCTCGTGTTTTGCAAAGACTGcgaggtttctttagttaaaagcc <-------------------#<-------------------# 1 1 1 1).Numbers above and below bases indicate the number of unique sRNAs with 5' ends overlapping the position on the sense and antisense strand, respectively. 2).Uppercase letters indicates the TAS region. 3).Gray shading indicates the phased positions within allowed offset. 4).Red shading indicates the start cleaved position. 5).Arrow bars indicate known phased region on TAS.

TasExpAnalysis    [Go Top]

Part2:Computatonal Result

1.Number of phased positions having sRNA hits

Allowed offset from phased position:2 Number of phased positions having sRNA hits:3 No.1 No.2 721 1 63 61 2 1 21 #------------------->#-------------------> tggaatactcacTTGAGCAAGAAATTATAAGCACCTCGTGTTTTGCAAAGACTGcgaggtttctttagttaaaagcc <-------------------#<-------------------# 1 1 1 No.3 No.-

2.Number of non-phased positions having sRNA hits

Allowed offset from phased position:2 Number of non-phased positions having sRNA hits:6 No.1 |No.2 || No.3 || | No.4 721 1 63 61 2 1 21 #------------------->#-------------------> tggaatactcacTTGAGCAAGAAATTATAAGCACCTCGTGTTTTGCAAAGACTGcgaggtttctttagttaaaagcc <-------------------#<-------------------# 1 1 1 No.5 No.6

3.P value

(

(L*2-1)-(L/21*2-1)-(L/21*2-1)*2*S

)

(

L/21*2-1

)

min(k1+k2,L/21*2-1)

k2

k1

P(k1)=


x=k1

(

(L*2-1)-(L/21*2-1)*2*S

)

k1+k2

where L, a multiple of 21, is the length of TAS, K1 is 
the number of phased positions having sRNA hits, K2 is the 
number of non-phased positions having sRNA hits, and s is 
the maximum allowed offset from phase position.

TasExpAnalysis    [Go Top]

Part3.sRNA Distribution

1.Distribution of unique sRNA on different phasing register

Register: 1 1 |2 |2 ................... ................... |||||||||||||||||||20|||||||||||||||||||20 ||||||||||||||||||||21|||||||||||||||||||21 |||||||||||||||||||||||||||||||||||||||||| 721 1 63 61 2 1 21 #------------------->#-------------------> tggaatactcacTTGAGCAAGAAATTATAAGCACCTCGTGTTTTGCAAAGACTGcgaggtttctttagttaaaagcc <-------------------#<-------------------# 1 1 1 |||||||||||||||||||21|||||||||||||||||||21 ||||||||||||||||||20|||||||||||||||||||20| .................. |. ................ | 2 |2 | 1 1 -------Computational Result ------ Number: Register 1: 7+6+1 Register 2: 2+3 ...... Register 20: 1+2 Register 21: 1 Percentage: Register 1: (7+6+1)/[(7+6+1)+(2+3)+...+(1+2)+(1)] Register 2: (2+3)/[(7+6+1)+(2+3)+...+(1+2)+(1)] ...... Register 20: (1+2)/[(7+6+1)+(2+3)+...+(1+2)+(1)] Register 21: 1/[(7+6+1)+(2+3)+...+(1+2)+(1)] Help on 'click to see radar chart': If you see 'You need to install Excel and allow all ActiveX to run in your browser!', please ensure firstly you have insatll Excel, and secondly, you need allow all related ActiveX to run, where the browser will remind you its unsafe. For error message "Microsoft JScript runtime error: Automation server can't create object", you can try to enable ActiveX controls and plug-ins in IE according to the following steps: Open IE -> Tools ->Internet Options -> Security -> Custom Level -> ActiveX controls and plug-ins ->All ActiveX: Enable (see below figure).
    

2.Distribution of reads on different phasing register

Register: 1 1 |2 |2 ................... ................... |||||||||||||||||||20|||||||||||||||||||20 ||||||||||||||||||||21|||||||||||||||||||21 |||||||||||||||||||||||||||||||||||||||||| 721 1 63 61 2 1 21 #------------------->#-------------------> tggaatactcacTTGAGCAAGAAATTATAAGCACCTCGTGTTTTGCAAAGACTGcgaggtttctttagttaaaagcc <-------------------#<-------------------# 1 1 1 |||||||||||||||||||21|||||||||||||||||||21 ||||||||||||||||||20|||||||||||||||||||20| .................. |. ................ | 2 |2 | 1 1 Register : Location (5' end) of sRNA reads and their sequencing number: Register 1: +TTGAGCAAGAAATTATAAG_1 +TTGAGCAAGAAATTATAAGC_1 +TTGAGCAAGAAATTATAAGCAC_1 +TTGAGCAAGAAATTATAAGCACC_1 +TTGAGCAAGAAATTATAAGCA_7 +TTGAGCAAGAAATTATAAGCACCT_1 +TTGAGCAAGAAATTATAA_1 Register 2: +TGAGCAAGAAATTATAAGC_6 +TGAGCAAGAAATTATAAGCA_8 Register 3: +GAGCAAGAAATTATAAGCA_15 Register 20: +CACCTCGTGTTTTGCAAAGAC_32 Register 1: +CCTCGTGTTTTGCAAAGACTGCG_1 +CCTCGTGTTTTGCAAAGACT_1 +CCTCGTGTTTTGCAAAGAC_1 +CCTCGTGTTTTGCAAAGA_1 +CCTCGTGTTTTGCAAAGACTG_29 +CCTCGTGTTTTGCAAAGACTGC_1 Register 2: +CTCGTGTTTTGCAAAGACTGC_26 +CTCGTGTTTTGCAAAGAC_5 +CTCGTGTTTTGCAAAGACTG_5 Register 4: +CGTGTTTTGCAAAGACTG_1 +CGTGTTTTGCAAAGACTGC_1 +CGTGTTTTGCAAAGACTGCG_1 +CGTGTTTTGCAAAGACTGCGA_30 +CGTGTTTTGCAAAGACTGCGAG_1 +CGTGTTTTGCAAAGACTGCGAGG_2 Register 5: +GTGTTTTGCAAAGACTGCGAGG_38 Register 9: +TTTGCAAAGACTGCGAGGTTTC_21 +TTTGCAAAGACTGCGAGGTTTCTT_21 Register 16: +AGACTGCGAGGTTTCTTTA_49 Register 20: +TGCGAGGTTTCTTTAGTTAAA_36 +TGCGAGGTTTCTTTAGTTAA_17 Register 21: +GCGAGGTTTCTTTAGTTAAA_54 Register 14: -TTCTTGCTCAAGTGAGTATTCCA_23 Register 1: -CTTATAATTTCTTGCTCAA_31 Register 12: -AACACGAGGTGCTTATAAT_42 -------Counting------ Register 1: 13 Register 2: 14 Register 3: 15 Register 20: 32 Register 1: 34 Register 2: 35 Register 4: 37 Register 5: 38 Register 9: 42 Register 16: 49 Register 20: 53 Register 21: 54 Register 14: 23 Register 1: 31 Register 12: 42 -------Computational Result ------ Number: Register 1: 13+34+31 Register 2: 14+35 ...... Register 20: 32+53 Register 21: 54 Percentage: Register 1: (13+34+31)/[(13+34+31)+(14+35)+...+(32+53)+(54)] Register 2: (14+35)/[(13+34+31)+(14+35)+...+(32+53)+(54)] ...... Register 20: (32+53)/[(13+34+31)+(14+35)+...+(32+53)+(54)] Register 21: 54/[(13+34+31)+(14+35)+...+(32+53)+(54)]

3.Distribution of reads length

Register: 1 1 |2 |2 ................... ................... |||||||||||||||||||20|||||||||||||||||||20 ||||||||||||||||||||21|||||||||||||||||||21 |||||||||||||||||||||||||||||||||||||||||| 721 1 63 61 2 1 21 #------------------->#-------------------> tggaatactcacTTGAGCAAGAAATTATAAGCACCTCGTGTTTTGCAAAGACTGcgaggtttctttagttaaaagcc <-------------------#<-------------------# 1 1 1 |||||||||||||||||||21|||||||||||||||||||21 ||||||||||||||||||20|||||||||||||||||||20| .................. |. ................ | 2 |2 | 1 1 Register : Location (5' end) of sRNA reads and their sequencing number: Register 1: +TTGAGCAAGAAATTATAAG_1 +TTGAGCAAGAAATTATAAGC_1 +TTGAGCAAGAAATTATAAGCAC_1 +TTGAGCAAGAAATTATAAGCACC_1 +TTGAGCAAGAAATTATAAGCA_7 +TTGAGCAAGAAATTATAAGCACCT_1 +TTGAGCAAGAAATTATAA_1 Register 2: +TGAGCAAGAAATTATAAGC_6 +TGAGCAAGAAATTATAAGCA_8 Register 3: +GAGCAAGAAATTATAAGCA_15 Register 20: +CACCTCGTGTTTTGCAAAGAC_32 Register 1: +CCTCGTGTTTTGCAAAGACTGCG_1 +CCTCGTGTTTTGCAAAGACT_1 +CCTCGTGTTTTGCAAAGAC_1 +CCTCGTGTTTTGCAAAGA_1 +CCTCGTGTTTTGCAAAGACTG_29 +CCTCGTGTTTTGCAAAGACTGC_1 Register 2: +CTCGTGTTTTGCAAAGACTGC_26 +CTCGTGTTTTGCAAAGAC_5 +CTCGTGTTTTGCAAAGACTG_5 Register 4: +CGTGTTTTGCAAAGACTG_1 +CGTGTTTTGCAAAGACTGC_1 +CGTGTTTTGCAAAGACTGCG_1 +CGTGTTTTGCAAAGACTGCGA_30 +CGTGTTTTGCAAAGACTGCGAG_1 +CGTGTTTTGCAAAGACTGCGAGG_2 Register 5: +GTGTTTTGCAAAGACTGCGAGG_38 Register 9: +TTTGCAAAGACTGCGAGGTTTC_21 +TTTGCAAAGACTGCGAGGTTTCTT_21 Register 16: +AGACTGCGAGGTTTCTTTA_49 Register 20: +TGCGAGGTTTCTTTAGTTAAA_36 +TGCGAGGTTTCTTTAGTTAA_17 Register 21: +GCGAGGTTTCTTTAGTTAAA_54 Register 14: -TTCTTGCTCAAGTGAGTATTCCA_23 Register 1: -CTTATAATTTCTTGCTCAA_31 Register 12: -AACACGAGGTGCTTATAAT_42 -------Counting------ 18nt 19nt 20nt 21nt 22nt 23nt 24nt Register 1: 1 1 1 7 1 1 1 Register 2: 6 8 Register 3: 15 Register 20: 32 Register 1: 1 1 1 29 1 1 Register 2: 5 5 26 Register 4: 1 1 1 30 1 2 Register 5: 38 Register 9: 21 21 Register 16: 49 Register 20: 17 36 Register 21: 54 Register 14: 23 Register 1: 31 Register 12: 42 -------Computational Result ------ 18nt 19nt 20nt 21nt 22nt 23nt 24nt Number: 8 146 87 178 62 27 1 Percentage: 8/503 146/503 87/503 178/503 62/503 27/503 1/503